Abstract
Abstract
Background: Peritoneal mesothelial cell (PMC) plays a key role in the process of peritoneal fibrosis. Epithelial–mesenchymal transition (EMT) of PMCs is an important mechanism of peritoneal fibrosis. Prolonged exposure to peritoneal dialysis fluid containing a high concentration of glucose may lead to EMT of PMCs. Cdc42-interacting protein-4 (CIP4) is a critical regulator of cell skeleton and downstream effector of Cdc42 and participates in EMT of tubular epithelial cells. In the present study, we investigate the possible role of CIP4 in EMT of PMC under high glucose (HG) condition in vitro and further explore the potential therapeutic point for peritoneal fibrosis. Methods: Rat peritoneal mesothelial cells (RPMCs) were isolated from the peritonea of rats by enzymatic digestion. Under HG conditions (1.5%, 2.5% and 4.25%), E-cadherin, α-SMA and CIP4 expression were assessed by Western blot. Effect of CIP4-siRNA and pcDNA3.1-CIP4 transfection on E-cadherin, α-SMA and CIP4 expression were also assessed respectively under 2.5% HG concentration. Cells were pretreated for 24 h with PI3K/Akt signaling inhibitor perifosine and effect of perifosine on CIP4 expression were detected by Western blot. Results: EMT induction by HG was confirmed by the prevalence of morphological changes, loss of E-cadherin, increase in α-SMA expression. CIP4-siRNA transfection can reverse EMT of RPMCs. Over-expression of CIP4 promoted characteristics similar to those commonly observed in EMT. Furthermore, the increased CIP4 in response to HG was efficiently inhibited by perifosine. Conclusion: This study shows that CIP4 promotes high glucose-induced EMT through PI3K-Akt signaling pathway in RPMCs.
Introduction
Peritoneal dialysis (PD) is used as a renal replacement therapy for end-stage renal diseases (ESRD). Despite of recent advances, peritoneal fibrosis, a serious complication of long-term PD patients, still exists in the treatment of PD, which largely limits the development of PD. Peritoneal mesothelial cell (PMC) plays a key role in the process of peritoneal fibrosis. In the environment of peritoneal dialysis fluid (PDF) with non-physiological high glucose (HG), its morphology and function will change correspondingly.1 Glucose is widely used as the osmotic agent for PDF because it is effective, inexpensive, easily metabolized and a natural source of energy. However, the use of glucose-based solutions has its disadvantages.2 Recently, in vivo and in vitro evidences have suggested that the epithelial–mesenchymal transition (EMT) of PMCs is an important mechanism in peritoneal fibrosis.3 EMT is a dynamic process in which epithelial cells undergo a phenotypic conversion that gives rise to a fibroblastoid appearance. These transformed cells that express α-smooth muscle actin (α-SMA) and lose their epithelial markers have a mesenchymal phenotype with increased ability to proliferate, migrate and synthesize extracellular matrix.4 Aroeira et al. found that prolonged exposure to PDF containing a high concentration of glucose may lead to EMT of PMCs.5
Cdc42 interacting protein 4 (CIP4) is a critical regulator of cell skeleton and downstream effector of Cdc42. Its main function is to regulate actin polymerization, membrane fluidity and cell phagocytosis, which plays an important role in the regulation of cellular structure and function, including cell shape, polarity and adhesive capacity.6,7 Previous study showed that over-expression of CIP4 caused cell transdifferentiation and EMT of tubular epithelial cells, through which CIP4 is capable of exacerbating progressive fibrosis in chronic renal failure.8,9 In vivo study also indicated that CIP4 protein was extensively expressed in the renal tubules in 5/6-nephrectomized rats which meant that CIP4 might play a role in EMT in vivo.9 So, it is likely that CIP4 may serve as a signaling molecule and a therapeutic point in peritoneal fibrosis.
The purpose of this study is to investigate the possible role of CIP4 participated in the pathogenesis of EMT of rat peritoneal mesothelial cell (RPMCs) under HG condition in vitro and further explore its potential mechanism for peritoneal fibrosis.
Materials and methods
Reagents
Antibodies of anti-phospho-Akt (Thr308) and anti-Akt were purchased from Cell Signaling Technology Inc. (Beverly, MA). RNAi primers, Lipofectamine 2000, OPTI-MEMI medium and M199 medium were purchased from Invitrogen (Carlsbad, CA). The primary monoclonal anti-E-cadherin, anti-α-SMA, anti-CIP4 and anti-β-actin antibodies, as well as horseradish peroxidase, were from Santa Cruz Biotech. Inc (Santa Cruz, CA). Perifosine, supplied by Keryx Biopharmaceuticals (New York, NY), was dissolved in PBS and stored at −20 °C. Fetal bovine serum (FBS), glucose (1.5%, 2.5%, 4.25%) and mannitol (45 mmol/L) were obtained from Sigma-Aldrich (St. Louis, MO). Plasmid pcDNA3.1-CIP4 was generously donated by Dr Zhenyu Lu (Tianjin Central Hospital of Obstetrics and Gynecology).
Primary culture of RPMCs
RPMCs were isolated from the peritonea of rats by enzymatic digestion as previously described.10 Briefly, male Wistar rats (Center of Experimental Animal, Institute of Radiation Medicine in Peking Union Medical College), weighing 180–220 g, were used in the study. 30–40 mL of 0.25% trypsinize and 0.02% EDTA-Na2 were infused into the rats’ abdominal cavities, from which all fluid was collected under sterile conditions two hours later. Isolated RPMCs were harvested and grown in M199 medium supplemented with 10% FBS, 2 mmol/L glutamine, 100 U/mL penicillin and 100 μg/mL streptomycin. To identify RPMCs, they were confirmed by morphological polygonal cobblestone appearance and expression of the mesothelial-specific marker Hector Battifora-mesothelin-1. Cells between passages 2 and 3 grown as a monolayer to 80% confluence were used for the following experiments.
EMT model of RPMCs induced by HG
RPMCs after being passaged and synchronized were divided into groups: (1) the control group, cultured in M199 medium without serum; (2) the HG groups, cultured for 72 h to induce EMT of RPMCs in M199 medium with different concentrations of HG (1.5%, 2.5%, 4.25%) and (3) the mannitol group, a control for osmolality in 1.5% HG, in 2.5% HG and in 4.25% HG conditions, cultured in M199 medium with mannitol. RPMCs of different groups were cultured for 72 h and morphology was observed through inverted microscope. The protein expression of E-cadherin and α-SMA were detected by Western blot.
Transfection of CIP4-siRNA
For small interfering RNA (siRNA) experiments, RNA primers complementary to Rat CIP4 were designed by the software of Invitrogen Biotechnology Company. The sense strand of CIP4 is 5′TTCTTCCCAAGATCGAAAATGTTT3′ and the antisense strand is 5′AACATACGCGCACAAAAAGCTGCA3′. For transfection, culture medium containing 1 × 107 RPMCs of the control group and the 2.5% HG group were placed in each hole of 6-hole culture plates and cultured at 37 °C in 5% CO2 condition to 40%–50% confluence. After washing with OPTI-MEMI, RPMCs were incubated in 1 mL OPTI-MEMI medium without FBS and treated with CIP4-siRNA-Lipofectamine 2000 mixture at 37 °C in 5% CO2 condition for 5 h according to the Lipofectamine 2000 manual. After treatment, they were cultured in 2 mL medium containing 10% FBS with or without 2.5% HG for 72 h. RPMCs were collected and CIP4 expression were detected by Western blot at 0, 12, 24, 48 and 72 h, respectively. In addition, expression of E-cadherin, α-SMA and CIP4 were detected by Western blot and compared for the control group and the 2.5% HG groups without or with CIP4-siRNA transfection for the time point of 72 h.
CIP4 over-expression in RPMCs
The plasmid pcDNA3.1-CIP4 was transfected into RPMCs by the Lipofectamine 2000 manual with a similar method of the above transfection of CIP4-siRNA. After transfection, they were cultured in 2 mL medium containing 10% FBS. Some RPMCs without any treatment is regarded as the control group and some other RPMCs transfected with an empty pcDNA3.1 vector as an additional negative control. Protein expression of E-cadherin, α-SMA and CIP4 were detected by Western blot and compared for the control group, the pcDNA3.1 group, the pcDNA3.1-CIP4 group and the 2.5% HG group.
Phosphatidylinositol-3-kinase (PI3K)/AKT inhibitor perifosine in RPMCs
Some RPMCs were cultured in M199 medium with 2.5% HG for 60 min. Expressions of phosphorylation (P-Akt) and Akt were detected by Western blot and ratio of P-Akt/Akt was calculated at 0, 10, 20, 40 and 60 min, respectively. Some other RPMCs were pretreated with perifosine at a concentration of 10 μM for 24 h and cultured in M199 medium with 2.5% HG for 72 h.11,12 The protein expression of CIP4 was detected by Western blot.
Western blot
Cells were washed twice with cold PBS, lysed on ice for 15 min with 30 µL lysis buffer (300 mM NaCl, 50 mM Tris–HCl, pH 7.5, 2 mM EDTA, 0.5% Triton X-100 and protease inhibitors) and centrifuged at 14,000 g for 10 min. Supernatants were collected and protein concentrations were detected by the BCA assay (Pierce, Rockford, IL) according to the manufacturer's protocol. Equal amounts of protein were loaded onto an 8% SDS-polyacrylamide gel with separated proteins transferred to nitrocellulose membranes. The membranes, blocked with phosphate-buffered saline (PBS) containing 5% nonfat milk and 0.1% Tween 20 for 1 h at room temperature, were incubated overnight with the indicated primary antibodies at 4 °C followed by incubation with secondary horseradish peroxidase antibodies according to the manufacturer’s instructions. All blots were developed by Western blot detection system of enhanced chemiluminescence and quantified with Image Pro Plus 5.0 software by optical density ration using β-actin as a loading control.
Statistical analysis
All values in the study were expressed as mean ± standard error of the mean 5–6 experiments and all analyses were performed by SPSS 15.0 software (Chicago, IL). Differences were considered significant at p < 0.05. Data were presented as Mean ± SEM and compared by Student t test or ANOVA as appropriate.
Result
Effect of HG on RPMCs morphology and E-cadherin, α-SMA expression
The normal RPMCs grew well like cobblestone in M199 medium with evidence of a tight cell–cell junction. After 72 h culture of RPMCs in HG conditions of different concentrations, it could be observed that few RPMCs were transdifferentiated to fibroblasts in M199 medium with 1.5% HG concentration, but RPMCs showed decrease in cell--cell contacts and transition to a more elongated morphological shape of myofibroblasts in those with 2.5% and 4.25% HG concentration (Figure 1).
Published online:
16 July 2013Figure 1. Morphological changes of RPMCs induced by high glucose of concentrations in 1.5%, 2.5% and 4.25%. C = the control group. (n = 5–6).
![]({"type":"image","src":"/na101/home/literatum/publisher/tandf/journals/content/irnf20/2013/irnf20.v035.i07/0886022x.2013.808957/20150616/images/medium/irnf_a_808957_f0001_b.jpg"})
Figure 1. Morphological changes of RPMCs induced by high glucose of concentrations in 1.5%, 2.5% and 4.25%. C = the control group. (n = 5–6).
Western blot analyses showed that compared to the control group, the protein expression of E-cadherin was significantly decreased in HG groups from 0.89 ± 0.08 to 0.63 ± 0.05 (1.5% HG group, p < 0.05), 0.40 ± 0.04 (2.5% HG group, p < 0.05) and 0.31 ± 0.03 (4.25% HG group, p < 0.05), while that of α-SMA was significantly increased from 0.33 ± 0.08 to 0.45 ± 0.04 (1.5% HG group, p < 0.05), 0.56 ± 0.05 (2.5% HG group, p < 0.05) and 0.71 ± 0.06 (4.25% HG group, p < 0.05). Mannitol, as an osmotic control for the control group, did not show a significant effect on protein expression of E-cadherin and α-SMA in RPMCs (p > 0.05) (Figure 2). The 2.5% HG group was successful to induce EMT of RPMCs and selected as the representative of the HG groups for following researches.
Published online:
16 July 2013Figure 2. Effect of different high glucose concentrations on protein expressions of E-cadherin and α-SMA assessed by Western blot. The bar graph showed the densitometric quantification of E-cadherin and α-SMA under indicated conditions with β-actin served as an internal control. ap < 0.05 versus the control group and the mannitol group. C = the control group, M = the mannitol group. (n = 5–6).
![]({"type":"image","src":"/na101/home/literatum/publisher/tandf/journals/content/irnf20/2013/irnf20.v035.i07/0886022x.2013.808957/20150616/images/medium/irnf_a_808957_f0002_b.jpg"})
Figure 2. Effect of different high glucose concentrations on protein expressions of E-cadherin and α-SMA assessed by Western blot. The bar graph showed the densitometric quantification of E-cadherin and α-SMA under indicated conditions with β-actin served as an internal control. ap < 0.05 versus the control group and the mannitol group. C = the control group, M = the mannitol group. (n = 5–6).
Effect of CIP4-siRNA transfection on CIP4 expression of RPMCs in the 2.5% HG condition
It could be observed that after CIP4-siRNA transfection, CIP4 protein expression of RPMCs was significantly inhibited and continued to decrease for 72 h. For RPMCs pretreated with CIP4-siRNA transfection and incubated in M199 medium of 2.5% HG, there has been no significant decrease in CIP4 expression all through 72 h (Figure 3).
Published online:
16 July 2013Figure 3. Effect of CIP4-siRNA transfection on CIP4 expression of RPMCs with the time prolonging assessed by Western blot. (A) CIP4-siRNA transfection without HG stimulation. (B) 2.5% HG stimulation pretreated with CIP4-siRNA transfection. (n = 5–6).
![]({"type":"image","src":"/na101/home/literatum/publisher/tandf/journals/content/irnf20/2013/irnf20.v035.i07/0886022x.2013.808957/20150616/images/medium/irnf_a_808957_f0003_b.jpg"})
Figure 3. Effect of CIP4-siRNA transfection on CIP4 expression of RPMCs with the time prolonging assessed by Western blot. (A) CIP4-siRNA transfection without HG stimulation. (B) 2.5% HG stimulation pretreated with CIP4-siRNA transfection. (n = 5–6).
Effect of CIP4-siRNA transfection on CIP4, E-cadherin, α-SMA expression of RPMCs under 2.5% HG condition
Taking 72 h as the time point, compared to the control group, immunoblotting showed that the 2.5% HG group significantly increased CIP4 and α-SMA protein expression (p < 0.05) and decreased E-cadherin expression (p < 0.05). CIP4 and α-SMA expression in the 2.5% HG + CIP4-siRNA group were significantly decreased compared to the 2.5% HG group, but higher than those in the control group. Compared to the 2.5% HG group, there was a significant increase in E-cadherin expression in the HG + CIP4-siRNA group, which was still lower than that in the control group (p < 0.05) (Figure 4).
Published online:
16 July 2013Figure 4. Expressions of CIP4, E-cadherin and α-SMA after 2.5% HG stimulation without or with pretreatment with CIP4-siRNA transfection for 72 h assessed by Western blot. The bar graph showed the densitometric quantification of CIP4, E-cadherin and α-SMA under indicated conditions with β-actin served as an internal control. ap < 0.05 versus the control group. bp < 0.05 versus the 2.5% HG group. C = the control group, I = the group of 2.5% HG stimulation pretreated with CIP4-siRNA transfection for 72 h. (n = 5–6).
![]({"type":"image","src":"/na101/home/literatum/publisher/tandf/journals/content/irnf20/2013/irnf20.v035.i07/0886022x.2013.808957/20150616/images/medium/irnf_a_808957_f0004_b.jpg"})
Figure 4. Expressions of CIP4, E-cadherin and α-SMA after 2.5% HG stimulation without or with pretreatment with CIP4-siRNA transfection for 72 h assessed by Western blot. The bar graph showed the densitometric quantification of CIP4, E-cadherin and α-SMA under indicated conditions with β-actin served as an internal control. ap < 0.05 versus the control group. bp < 0.05 versus the 2.5% HG group. C = the control group, I = the group of 2.5% HG stimulation pretreated with CIP4-siRNA transfection for 72 h. (n = 5–6).
Effect of CIP4 gene over-expression on E-cadherin, α-SMA expression of RPMCs
Seventy-two hours after plasmid pcDNA3.1-CIP4 transfection, Western blotting showed, compared to the control group and the pcDNA 3.1 group, there was a significant increase in protein expression of α-SMA and CIP4 in the pcDNA3.1-CIP4 group (p < 0.05) and a significant decrease in expression of E-cadherin (p < 0.05), which has a similar results with the group after 2.5% HG stimulation (Figure 5).
Published online:
16 July 2013Figure 5. Effect of CIP4 over-expression on protein expressions of CIP4, E-cadherin and α-SMA assessed by Western blot. The bar graph showed the densitometric quantification of CIP4, E-cadherin and α-SMA under indicated conditions with β-actin served as an internal control. ap > 0.05 versus the control group. bp < 0.05 versus the control group and the pcDNA 3.1 group. C = the control group. T0 = the group transfected with only pcDNA3.1 vector. T1 = the group transfected with pcDNA3.1-CIP4. (n = 5–6).
![]({"type":"image","src":"/na101/home/literatum/publisher/tandf/journals/content/irnf20/2013/irnf20.v035.i07/0886022x.2013.808957/20150616/images/medium/irnf_a_808957_f0005_b.jpg"})
Figure 5. Effect of CIP4 over-expression on protein expressions of CIP4, E-cadherin and α-SMA assessed by Western blot. The bar graph showed the densitometric quantification of CIP4, E-cadherin and α-SMA under indicated conditions with β-actin served as an internal control. ap > 0.05 versus the control group. bp < 0.05 versus the control group and the pcDNA 3.1 group. C = the control group. T0 = the group transfected with only pcDNA3.1 vector. T1 = the group transfected with pcDNA3.1-CIP4. (n = 5–6).
Effect of PI3K/AKT inhibitor perifosine on CIP4 expression
After 2.5% HG stimulation for 10 minutes, P-Akt level was significantly higher (p < 0.05) and has been remaining in the high level with time prolonging to 60 min (Figure 6).
Published online:
16 July 2013Figure 6. Effect of 2.5% HG stimulation on protein expression of Akt and P-Akt with the time prolonging assessed by Western blot. The bar graph showed the densitometric ratio of P-Akt and Akt. ap < 0.05 versus the group with 2.5% HG stimulation at 0 min. P-Akt = phospho-Akt. (n = 5–6).
![]({"type":"image","src":"/na101/home/literatum/publisher/tandf/journals/content/irnf20/2013/irnf20.v035.i07/0886022x.2013.808957/20150616/images/medium/irnf_a_808957_f0006_b.jpg"})
Figure 6. Effect of 2.5% HG stimulation on protein expression of Akt and P-Akt with the time prolonging assessed by Western blot. The bar graph showed the densitometric ratio of P-Akt and Akt. ap < 0.05 versus the group with 2.5% HG stimulation at 0 min. P-Akt = phospho-Akt. (n = 5–6).
It could be observed that CIP4 protein expression was significantly higher in the 2.5% HG group than that in the control group (p < 0.05), but the increased CIP4 expression in response to HG was efficiently inhibited by pretreatment with perifosine in the perifosine group (p < 0.05) (Figure 7).
Published online:
16 July 2013Figure 7. Effect of perifosine on CIP4 expression after 2.5% HG stimulation assessed by Western blot. The bar graph showed the densitometric quantification of CIP4 under indicated conditions with β-actin served as an internal control. ap < 0.05 versus the control group. bp < 0.05 versus the 2.5% HG group. C = the control group, p = the group of 2.5% HG stimulation pretreated with perifosine. (n = 5–6).
![]({"type":"image","src":"/na101/home/literatum/publisher/tandf/journals/content/irnf20/2013/irnf20.v035.i07/0886022x.2013.808957/20150616/images/medium/irnf_a_808957_f0007_b.jpg"})
Figure 7. Effect of perifosine on CIP4 expression after 2.5% HG stimulation assessed by Western blot. The bar graph showed the densitometric quantification of CIP4 under indicated conditions with β-actin served as an internal control. ap < 0.05 versus the control group. bp < 0.05 versus the 2.5% HG group. C = the control group, p = the group of 2.5% HG stimulation pretreated with perifosine. (n = 5–6).
Discussion
PD has been an accepted form of renal replacement therapy (RRT) for patients with ESRD in the past decades and the number of patients has increased progressively worldwide, especially in some Asian countries.13 Solutions with HG concentrations are usually used to maintain fluid balance in patients who are in PD programs. Many evidences implicated that repeated exposure to HG and glucose degradation products contained in non-physiologic PDF was the major cause of peritoneal membrane deterioration.14 It was known that high concentrations of glucose induced EMT of human PMC, suggested by decreased expression of E-cadherin and increased expression of α-SMA.15 YH Liu concluded that the earlier marker of EMT was the disruption of cells’ connection which meant the disorder of E-cadherin distribution and function loss.16 However, mechanisms of the RPMC connection destruction and EMT afterward induced by HG still remain obscure.
In the present study, we showed that 1.5%, 2.5% and 4.25% HG could cause EMT of RPMCs in vitro, which is confirmed by morphological changes of RPMCs, decreased protein expression of E-cadherin and increased expression of α-SMA. Although osmotic pressure also affects cell signaling pathways, in the present study, mannitol did not affect protein expression of E-cadherin and α-SMA, indicating that osmotic pressure had little effect on EMT of RPMCs induced by HG. To determine the role of CIP4 in the regulation of EMT of RPMCs, we selected 2.5% HG concentration as the representative of HG for the following experiments and found that 72 h of 2.5% HG stimulation significantly increased CIP4 protein expression. Based on the above results, we hypothesized that 2.5% HG could induce EMT of RPMCs via upregulating CIP4 expression. To prove this hypothesis, RPMCs were investigated after being inhibited and strengthened protein expression of CIP4, which showed that inhibition of CIP4 partly reversed HG induced EMT of RPMCs and CIP4 over-expression had a similar result of EMT with HG stimulation. So, CIP4 functioned in a positively regulative role in HG induced EMT of RPMCs. To our knowledge, this is the first report that shows CIP4 may participate in HG induced EMT of RPMCs.
Recent studies found that epithelial cell–cell junctions metabolized and circulated on the cell surface and adjusted the spatial redistribution of E-cadherin, facilitating cell adhesion, cell polarity and cell reorganization to maintain the normal cell morphologies through endocytosis and exocytosis.17,18 Any factors affecting E-cadherin endocytosis and exocytosis would influence the normal cell morphology, leading to the occurrence of EMT.19 In epithelial tissue, CIP4 has been identified to be primarily involved in endocytosis and exocytosis, transporting transmembrane protein molecules, of which E-cadherin endocytosis was regulated through Cdc42-Par6-aPKC pathway, thus affecting epithelial cells’ adhesive capacity and maintaining their stability.20 Since the polar compound Cdc42-Par6-aPKC is an important epithelial cell–cell junction, it is speculated that CIP4 may induce EMT of RPMCs through Cdc42-Par6-aPKC dependent pathway.
Perifosine, a novel PI3K/Akt signaling inhibitor, may exert its biological effects by dephosphorylating Akt.21 PI3K generates membrane-bound phosphoinositide, which act as second messengers in the recruitment of Akt to the membrane where it becomes activated by phosphorylation.22 Akt can then phosphorylate and activate several other proteins that functioned in EMT.23 In our study, protein expression of CIP4 was significantly increased after 2.5% HG stimulation, which, however, was apparently decreased by pretreatment with perifosine for 24 h at a concentration of 10 μM. In addition, after HG stimulation in RPMCs, phosphorylation levels of Thr308 sites were significantly higher and continued to maintain in the high level with the time prolonging. However, it is important to note that perifosine also mediates its effects through other mechanisms which seem to be PI3K/AKT independent. It has been reported that perifosine could suppress the activation of Smad1 by bone morphogenetic protein 4 (BMP4) which promote EMT in squamous cell carcinoma of the head and neck.24,25 So, it might be concluded that HG could up-regulate CIP4 expression by activating, at least in part, PI3K-Akt signal transduction pathway. It is well known that HG can stimulate TGF-β1 in the PMCs and TGF-β1 is one of the key growth factors involved in EMT and pathological process of peritoneal fibrosis.26,27 TGF-β1 is also an upstream regulator of PI3K-Akt.28 Smads are the major transducers of TGF-β signalling.29 Therefore, it may be considered that HG can up-regulate the expression of TGF-β1 and then activate PI3K-Akt (Figure 8).
Published online:
16 July 2013Figure 8. Current hypothesis on the suppression of cytokine-induced CIP4 expression by perifosine in RPMCs.
![]({"type":"image","src":"/na101/home/literatum/publisher/tandf/journals/content/irnf20/2013/irnf20.v035.i07/0886022x.2013.808957/20150616/images/medium/irnf_a_808957_f0008_b.jpg"})
Figure 8. Current hypothesis on the suppression of cytokine-induced CIP4 expression by perifosine in RPMCs.
The data presented here confirms that HG dialysate regulates CIP4 protein expression through PI3K-Akt signaling pathway in the processes of EMT of RPMCs. This may be served as a valuable resource for exploring molecular mechanisms underlying peritoneal fibrosis. More development and application of CIP4 antagonists remain to be performed to further validate the potential therapeutic target of peritoneal fibrosis.
Declaration of interest
The authors report no conflicts of interest.
References
- Lai KN, Lai KB, Lam CW, et al. Changes of cytokine profiles during peritonitis in patients on continuous ambulant peritoneal dialysis. Am J Kidney Dis. 2000;35:644–652 [Google Scholar]
- Mortier S, De Vriese AS, Lameire N. Recent concepts in the molecular biology of the peritoneal membrane--implications for more biocompatible dialysis solutions. Blood Purif. 2003;21:14–23 [Google Scholar]
- Yang AH, Chen JY, Lin JK. Myofibroblastic conversion of mesothelial cells. Kidney Int. 2003;63:1530–1539 [Google Scholar]
- Li Y, Yang J, Dai C, et al. Role for integrin-linked kinase in mediating tubular epithelial to mesenchymal transition and renal interstitial fibrogenesis. J Clin Invest. 2003;112:503–516 [Crossref], [PubMed], [Web of Science ®], [Google Scholar]
- Aroeira LS, Loureiro J, Gonzalez–Mateo GT, et al. Characterization of epithelial-to-mesenchymal transition of mesothelial cells in a mouse model of chronic peritoneal exposure to high glucose dialysate. Perit Dial Int. 2008;28:S29–S33 [Google Scholar]
- Fiche R, Gohl C, Dharmalingam E, et al. Drosophila Clip4/Toca-1 integrates membrane trafficking and actin dynamics through WASP and SCAR/WAVE. Curr Biol. 2009;19:1429–1437 [Google Scholar]
- Henne WM, Boucrot E, Meinecke M, et al. FCHO proteins are nucleators of clathrin-mediated endocytosis. Science. 2010;8:1281–1284 [Google Scholar]
- Christina SP, Constadina A, Sean MH, et al. Cdc42-interacting protein 4 promotes breast cancer cell invasion and formation of invadopodia through activation of N-WASp. Cancer Res. 2010;70:8347–8356 [Google Scholar]
- Bai S, Zeng R, Zhou Q, et al. Cdc42-interacting protein-4 promotes TGF-β1-induced epithelial--mesenchymal transition and extracellular matrix deposition in renal proximal tubular epithelial cells. Int J Biol Sci. 2012;8:859–869 [Google Scholar]
- Zhang YF, Yang X, Zhang YJ, et al. Peroxisome proliferator-activated receptor-gamma is expressed by rat peritoneal mesothelial cells: its potential role in peritoneal cavity local defense. Am J Nephrol. 2006;26:602–611 [Google Scholar]
- de la Peña L, Burgan WE, Carter DJ, et al. Inhibition of Akt by the alkylphospholipid perifosine does not enhance the radiosensitivity of human glioma cells. Mol Cancer Ther. 2006;5:1504–1510 [Google Scholar]
- Fu L, Kim YA, Wang X, et al. Perifosine inhibits mammalian target of rapamycin signaling through facilitating degradation of major components in the mTOR axis and induces autophagy. Cancer Res. 2009;69:8967–8976 [Crossref], [PubMed], [Web of Science ®], [Google Scholar]
- Grassmann A, Gioberge S, Moeller S, et al. ESRD patients in 2004: global overview of patient numbers, treatment modalities and associated trends. Nephrol Dial Transplant. 2005;20:2587–2593 [Crossref], [PubMed], [Web of Science ®], [Google Scholar]
- Loureiro J, Schilte M, Aguilera A, et al. BMP-7 blocks mesenchymal conversion of mesothelial cells and prevents peritoneal damage induced by dialysis fluid exposure. Nephrol Dial Transplant. 2010;25:1098–1108 [Crossref], [Web of Science ®], [Google Scholar]
- Yu MA, Shin KS, Kim JH, et al. HGF and BMP-7 ameliorate high glucose-induced epithelial-to-mesenchymal transition of peritoneal mesothelium. J Am Soc Nephrol. 2009;20:567–581 [Crossref], [Web of Science ®], [Google Scholar]
- Liu YH. Epithelial to mesenchymal transition in renal fibrogenesis: pathologic significance, molecular mechanism, and therapeutic intervention. J Am Soc Nephrol. 2004;15:1–12 [Crossref], [PubMed], [Web of Science ®], [Google Scholar]
- Matthieu C, Thomas L. Molecular bases of cell–cell junctions stability and dynamics. Cold Spring Harb Perspect Biol. 2009;1:a002998 [Google Scholar]
- Jinn Y, Inase N. Connexin43, E-Cadherin, β-Catenin and ZO-1 expression, and aberrant methylation of the Connexin43 gene in NSCLC. Anticancer Res. 2010;30:2271–2278 [Google Scholar]
- Wirtz-Peitz F, Zallen JA. Junctional trafficking and epithelial morphogenesis. Curr Opin Genet Dev. 2009;19:350–356 [Crossref], [PubMed], [Web of Science ®], [Google Scholar]
- Leibfried A, Fricke R, Morgan M, et al. Drosophila Cip4 and WASp define a branch of the Cdc42-Par6-aPKC pathway regulating E-cadherin endocytosis. Curr Biol. 2008;18:1639–1648 [Crossref], [PubMed], [Web of Science ®], [Google Scholar]
- Hideshima T, Catley L, Yasui H, et al. Perifosine, an oral bioactive novel alkylphospholipid, inhibits Akt and induces in vitro and in vivo cytotoxicity in human multiple myeloma cells. Blood. 2006;107:4053–4062 [Crossref], [PubMed], [Web of Science ®], [Google Scholar]
- Mora A, Komander D, van Aalten DM, et al. PDK1, the master regulator of AGC kinase signal transduction. Semin Cell Dev Biol. 2004;15:161–170 [Crossref], [PubMed], [Web of Science ®], [Google Scholar]
- Lee YJ, Han HJ. Troglitazone ameliorates high glucose-induced EMT and dysfunction of SGLTs through PI3K/Akt, GSK-3β, Snail1, and β-catenin in renal proximal tubule cells. Am J Physiol Renal Physiol. 2010;298:F1263–F1275 [Crossref], [PubMed], [Web of Science ®], [Google Scholar]
- Wahdan-Alaswad RS, Song K, Krebs TL, et al. Insulin-like growth factor I suppresses bone morphogenetic protein signaling in prostate cancer cells by activating mTOR signaling. Cancer Res. 2010;70:9106–9117 [Google Scholar]
- Xu T, Yu CY, Sun JJ, et al. Bone morphogenetic protein-4-induced epithelial--mesenchymal transition and invasiveness through Smad1-mediated signal pathway in squamous cell carcinoma of the head and neck. Arch Med Res. 2011;42:128–137 [Google Scholar]
- Ha H, Lee HB. Effect of high glucose on peritoneal mesothelial cell biology. Perit Dial Int. 2000;20(Suppl 2):S15–S18 [Google Scholar]
- Margetts PJ, Bonniaud P. Basic mechanisms and clinical implications of peritoneal fibrosis. Perit Dial Int. 2003;23:530–541 [PubMed], [Web of Science ®], [Google Scholar]
- Jung SA, Lee HK, Yoon JS, et al. Upregulation of TGF-beta-induced tissue transglutaminase expression by PI3K-Akt pathway activation in human subconjunctival fibroblasts. Invest Ophthalmol Vis Sci. 2007;48:1952–1958 [Google Scholar]
- Saitoh M, Miyazawa K. Transcriptional and post-transcriptional regulation in TGF-β-mediated epithelial--mesenchymal transition. J Biochem. 2012;151:563–571 [Google Scholar]