Abstract
Abstract
Growth differentiation factor 15 (GDF15) is a divergent member of the transforming growth factor-β (TGF-β) superfamily that has been associated with colorectal cancers (CRC). However, the role of GDF15 in the progression of CRC remains unknown. We demonstrated that GDF15 expression was higher in fresh CRC tissues than in adjacent normal tissues. Moreover, we found that GDF15 overexpression significantly facilitated cell viability, cell invasion and migration (p < .01 or p < .05). The protein expression of N-cadherin, vimentin and Twist1 were up-regulated by GDF15 overexpression, while E-cadherin was down-regulated. Reciprocally, using a GDF15-shRNA strategy, we observed that GDF15 downregulation inhibited both basal and GDF16-induced cell viability, invasion and migration in LoVo cells. In conclusion, GDF15 could promote cell viability, invasion and migration of LoVo cells through EMT induction.
Introduction
Colorectal cancer (CRC) is one of the common digestive system malignancies. The morbidity and mortality are higher and rising [1]. Although medical technologies have been developed, the effects on prevention and control of malignant tumours are little [2]. There is no significant improvement in 5-year survival rate of advanced CRC and the mortality rate has not been significantly reduced. Metastasis is a major reason of cancer-related deaths [3]. Therefore, researches on tumour metastasis related genes are critical for predicting early metastasis, reducing metastasis incidence and improving the survival rate of CRC.
Growth differentiation factor 15 (GDF15) is a divergent member of the transforming growth factor-β (TGF-β) superfamily. The dysregulation of GDF15 expression has been associated with diverse human diseases development and cancer progression. It has been verified as a regulator in a variety of biological processes and cellular functions [4], such as cell apoptosis, differentiation and proliferation. Recently, multiple studies reported that GDF15 was elevated in several cancers, including pancreatic ductal adenocarcinoma [5], endometrial cancer [6], gastric cancer [7] and CRC [8]. However, the pathophysiologic role and relevance of GDF15 to CRC proliferation and metastasis are still unknown.
The epithelial to mesenchymal transition (EMT) is a process characterized by loss of cell–cell adhesion and gain of migratory and invasive traits. The transdifferentiation from quiescent epithelial cells into motile mesenchymal cells is essential for embryogenesis, fibrosis, tissue repair, wound healing and tumour progression [9,10]. Under pathological conditions, the EMT occurs at the initial stage of cancer metastasis. A number of key transcription factors were identified to potentiate EMT progression such as TWIST, ZEB1, ZEB2, SNAIL1 and SNAIL2 [11,12]. Meanwhile, the expression of mesenchymal markers vimentin would increase and hence contribute to cell motility and adhesion [13]. This is one of the most important mechanisms that promotes metastasis and thereby increases tumour aggressiveness. GDF15 is one of the most important transcriptional regulators, which promotes the EMT process and metastasis in malignancy by inducing the expression of certain EMT regulators, such as Snail, ZEB1, TWIST and so on [14–16]. However, whether GDF15 activates other critical EMT regulators in CRC, which may have differential and non-redundant roles, remains to be explored further.
In this study, we showed the GDF15 overexpression promoted CRC cell proliferation, migration and invasion. Moreover, GDF15 expression significantly correlated with poor outcomes for CRC patients. Furthermore, GDF15 overexpression enhanced EMT, which was induced by TGF-β in LoVo cells. Taken together, our results showed for the first time that GDF15 expression promotes CRC development and progression.
Materials and methods
Cell culture
Human CRC cell line LoVo was obtained from the Chinese Academy of Sciences Cell Bank of Type Culture Collection (Shanghai, China) and cultured in Dulbecco’s modified Eagle medium (DMEM) supplemented with 10% foetal bovine serum (FBS), 100 IU/mL penicillin and 100 mg/mL streptomycin (Life Technologies, Rockville, MD).
Tissue samples
Colorectal cancer patients (n = 50) who were scheduled for colonoscopy or surgical resection were analysed in the study. Primary tumour samples and the corresponding non-cancerous matched tissues were obtained by biopsy or from surgical resection. The fresh specimens were immediately stored in liquid nitrogen for RNA extraction and further analysis GDF15 expression levels using qRT-PCR and immunohistochemistry (IHC). This study was approved by the local clinical research ethics committee.
Establishment of stable GDF15 knockdown or over-expression cells
The full coding sequence of GDF15 was amplified and cloned into p3xFLAGCMV-14 (Sigma, St. Louis, MO) to constructed GDF15-Flag vector. The GDF15-shRNA vector was constructed using pLKO.1 lentivirus vector. Empty vector and scrambled shRNA were acted as control groups. For cell transfection, cells were seeded into six-well plates and divided into six groups and transfected or co-transfected with empty vector, GDF15-Flag vector, scramble shRNA, GDF15-shRNA, GDF15-Flag vector and scramble shRNA, GDF15-Flag vector and GDF15-shRNA. All the transfection was performed using Lipofectamine (Invitrogen, Carlsbad, CA) according to the manufacturer’s instructions. The sequences of shRNA against GDF15 were as follows: shRNA-F: CCGGGCTCCAGACCTATGACTTCTCGAGTCATCATAGGTCTGGAGCTTTTTG, shRNA-R: AATTCAAAAAGCTCCAGACCTATGATGACTTCTCGAGAAGTCATCATAGGTCTGGAGC.
RNA isolation and quantitative real-time PCR
Total RNA was isolated using TRIzol (Invitrogen, Carlsbad, CA). Reverse transcription with random hexamer primers was performed with an Ominscript RT kit (Qiagen, Valencia, CA). The sequences of the primers used for the amplification of GDF15 255 bp cDNA were forward 5′-TCAGATGCTCCGTGTTGC-3′ and reverse 5′-GATCCCAGCCGCACTTCTG-3′. We used the SYBR Premix Ex Taq TM Green II (TaKaRa Biotechnology Co., Ltd. Dalian, China) for real-time PCR reactions, and the relative expressions were calculated using the formula 2–ΔΔCt methods. GAPDH was used as the relative control for the analysis of mRNA levels.
Cell viability assay
Cells were seeded into a 96-well plate with a density of 1 × 104 cells/mL. Cell viability was examined using the 3-(4,5-dimethylthiazol-2-yl)-2,5-di-phenyltetrazolium bromide (MTT) assay. After culture for 48 h, 10 μL MTT solution (5 mg/mL, Beyotime, Shanghai, China) was added into each well and cultured for 4 h. The absorbance at 490 nm was measured after 150 μL dimethylsulphoxide (DMSO, Sigma, St. Louis, MO) added and shaken for 10 min. The curve of cell proliferation was then drawn and the proliferation efficiency was examined. The experiments were repeated three times independently.
Migration and invasion assays
The migration potential of cells was measured in 6.5 mm Transwell with 8.0-mm pore polycarbonate membrane insert (Corning, NY). Cells (1 × 105) in 200 μL of DMEM medium containing 1% FBS were seeded onto the upper chamber, and the lower chambers were filled with 600 μL of DMEM medium containing 20% FBS as chemoattractant. The cells were uncoated for the migration assay, or coated with a thin layer of BD Matrigel Matrix (BD Biosciences, Sparks, MD) for the invasion assay according to the manufacturer’s protocol. After incubated for 24 h, cells that had migrated and invaded were fixed with 4% paraformaldehyde and subsequently stained with 0.1% crystal violet for assessment. The experiments were repeated three times independently.
Western blot analysis
Protein expression levels were analysed by Western blot. Briefly, the cells were harvested and lysed on ice for 30 min in buffer. After centrifugation, the concentrations of protein were determined and separated by 10% sodium dodecyl sulphate-polyacrylamide gel electrophoresis. Then, protein was transferred to a polyvinylidene fluoride (PVDF) membrane. The membrane was incubated into rabbit anti-GDF15 (1:1500; Proteintech, Rosemont, IL), E-cadherin (Santa Cruz Biotechnology, Santa Cruz, CA), N-cadherin (Cell Signaling Technology, Beverly, MA), Vimentin, Twist1 and mouse anti-β-actin (1:6000; Cell Signaling Technology, Beverly, MA) at 4 °C overnight. Then, the membrane was then incubated with secondary peroxidase-conjugated antibodies for 2 h. Blots were treated with chemiluminescence reagents (Santa Cruz Biotechnology, Santa Cruz, CA) as per the manufacturer’s instructions and analysed by Image J software (Bethesda, MD).
Statistical analysis
All statistical analyses were carried out using the SPSS 18.0 software (SPSS, Inc., Chicago, IL). All values are expressed as the mean ± standard deviation from at least three repeated individual experiments for each group. The significant differences were analysed using Student’s t-test or χ2 analysis for difference between two groups, and one-way ANOVA followed by Kruskal–Wallis’s H test for multiple comparison. Differences were considered significant when p < .05.
Results
GDF15 overexpression in CRC tissues compared with matched non-cancerous
We first examined GDF15 mRNA expression by qRT-PCR in 50 pairs of human CRC tissues and matched non-cancerous colonic mucosa. As shown in Figure 1(A), the cancer tissues exhibited higher GDF15 expression relative to their corresponding non-cancerous controls. Next, we detected GDF15 expression in situ by IHC in tissue specimens. We found that GDF15 overexpressed in cancer tissues (Figure 1(B)). These findings demonstrated that GDF15 was overexpressed in CRC.
Published online:
17 May 2018Figure 1. GDF15 expression in CRC was higher than normal tissues. (A) GDF15 expression by qRT-PCR in 50 pairs of colon cancer and matched non-cancerous colonic tissues (normal), **p < .01. (B) GDF15 expression in normal and malignant human colorectal tissues was detected by IHC. Scale bars, 100 μm in B. All experiments were repeated at least twice.
![]({"type":"image","src":"/na101/home/literatum/publisher/tandf/journals/content/ianb20/2018/ianb20.v046.sup02/21691401.2018.1466146/20201021/images/medium/ianb_a_1466146_f0001_c.jpg"})
Figure 1. GDF15 expression in CRC was higher than normal tissues. (A) GDF15 expression by qRT-PCR in 50 pairs of colon cancer and matched non-cancerous colonic tissues (normal), **p < .01. (B) GDF15 expression in normal and malignant human colorectal tissues was detected by IHC. Scale bars, 100 μm in B. All experiments were repeated at least twice.
The effect of transfection on GDF15 expression
LoVo cells were divided into six groups and transfected with vector and/or shRNAs against GDF15, respectively. Then, RT-PCR (Figure 2(A)) and Western blot (Figure 2(B)) were performed to testify the transfection efficiency. As expected, both the mRNA and protein levels of GDF15 were significantly up-regulated by transfection with GDF15-Flag, and were down-regulated by transfection with GDF15-shRNA when compared to theirs corresponding controls (p < .01). In addition, GDF15 were significantly down-regulated by co-transfection with GDF15-Flag and GDF-15-shRNA, compared to GDF15-Flag + scramble group (p < .01). Thus, the six transfected cell groups were used for the following analyses.
Published online:
17 May 2018Figure 2. The effect of transfection of GDF15 expression. LoVo cells were divided into six groups and were transfected with vector and/or shRNAs against GDF15. Then the transfection efficiency was determined by RT-PCR (A) and Western blot (B), **p < .01.
![]({"type":"image","src":"/na101/home/literatum/publisher/tandf/journals/content/ianb20/2018/ianb20.v046.sup02/21691401.2018.1466146/20201021/images/medium/ianb_a_1466146_f0002_c.jpg"})
Figure 2. The effect of transfection of GDF15 expression. LoVo cells were divided into six groups and were transfected with vector and/or shRNAs against GDF15. Then the transfection efficiency was determined by RT-PCR (A) and Western blot (B), **p < .01.
GDF15 overexpression promoted cell proliferation
The effect of GDF15 on cell viability was investigated by MTT. As results shown in Figure 3, cell viability was significantly promoted by GDF15-Flag, while was inhibited by GDF15-shRNA, and the promotional effect of GDF15-Flag on cell viability was significantly abolished by the GDF15-shRNA (all p < .01). Therefore, elevated GDF15 might promote LoVo cells viability.
Published online:
17 May 2018Figure 3. The effect of GDF15 on cell viability. After the cells were transfected with vector and/or shRNAs against GDF15, cell viability was measured by MTT analysis, **p < .01.
![]({"type":"image","src":"/na101/home/literatum/publisher/tandf/journals/content/ianb20/2018/ianb20.v046.sup02/21691401.2018.1466146/20201021/images/medium/ianb_a_1466146_f0003_c.jpg"})
Figure 3. The effect of GDF15 on cell viability. After the cells were transfected with vector and/or shRNAs against GDF15, cell viability was measured by MTT analysis, **p < .01.
GDF15 up-regulation promotes cell migration and invasion
The effect of GDF15 on cell migration and invasion was investigated by Transwell. Results in Figure 4(A) showed that elevated GDF15 significantly facilitated invasion, while the GDF15-shRNA suppressed invasion and significantly abolished the facilitative impact of GDF15-Flag on invasion (all p < .05). The results of Transwell (Figure 4(B)) for measuring migration showed that migration was also significantly facilitated by elevated GDF15, and was suppressed by GDF15-shRNA. Moreover, GDF15-shRNA significantly recovered the impacts of GDF15-Flag on migration (p < .05). Taken together, elevated GDF15 might promote LoVo cells invasion and migration.
Published online:
17 May 2018Figure 4. The effect of GDF15 on cell invasion and migration. After the cells were transfected with vector and/or shRNAs against GDF15, cell invasion was determined by Transwell assay (A), meanwhile cell migration was conducted by Transwell (B), *p < .05.
![]({"type":"image","src":"/na101/home/literatum/publisher/tandf/journals/content/ianb20/2018/ianb20.v046.sup02/21691401.2018.1466146/20201021/images/medium/ianb_a_1466146_f0004_c.jpg"})
Figure 4. The effect of GDF15 on cell invasion and migration. After the cells were transfected with vector and/or shRNAs against GDF15, cell invasion was determined by Transwell assay (A), meanwhile cell migration was conducted by Transwell (B), *p < .05.
GDF15 promoted tumour epithelial–mesenchymal transition
Next, the mechanism by which GDF15 promoted tumour invasion and migration was determined by measuring the expression changes of EMT-related factors. Western blot analysis showed that (Figure 5) the protein levels of N-cadherin, vimentin and Twist1 were remarkably up-regulated by GDF15-Flag, while E-cadherin was remarkably down-regulated. GDF15 down-regulation increased E-cadherin protein expression while it decreased the expression of N-cadherin, vimentin and Twist1. The effect of GDF15 on cell invasion and migration might be via regulating the expression of EMT-related factors.
Published online:
17 May 2018Figure 5. The effect of GDF15 on EMT-related factors. The expression changes of EMT-related factors in the cells transfected with vector and/or shRNAs against GDF15 were measured by Western blot.
![]({"type":"image","src":"/na101/home/literatum/publisher/tandf/journals/content/ianb20/2018/ianb20.v046.sup02/21691401.2018.1466146/20201021/images/medium/ianb_a_1466146_f0005_c.jpg"})
Figure 5. The effect of GDF15 on EMT-related factors. The expression changes of EMT-related factors in the cells transfected with vector and/or shRNAs against GDF15 were measured by Western blot.
Discussion
Multiple evidences indicated that elevated GDF15 was frequently observed in many types of cancers and regulated a variety of biological processes and cellular functions [7]. However, the role of GDF15 in CRC cells has not been well clarified yet. The present study indicated that the elevated GDF15 in LoVo cells could significantly promote cell viability, invasion and migration. Additionally, the expression of EMT-related factors, N-cadherin, vimentin and Twist1, was remarkably up-regulated by the elevated GDF15, and E-cadherin was remarkably down-regulated. These results might provide a basic understanding of GDF15 in CRC.
GDF15 has been widely investigated as a regulator in many biological progresses, such as cell cycle, apoptosis, invasion, metastasis and immunosuppression [17]. Nowadays, multiple studies found that GDPF15 served as both cancer suppressive factor and EMT, depending on tumour type. In glioblastoma cells, GDF15 exerts anti-tumorigenic activities via acting itself as an intercessor of cellular stress signalling [18,19]. Lee et al. demonstrated that GDF15 was overexpressed in gastric tumour tissues and the overexpression of GDF15 was well correlated with invasive potential of tumour [7]. Zhang et al. found that expression of GDF15 was positively correlated with the malignancy of oral squamous cell carcinoma, and GDF15 could promote tumour cells proliferation and colony formation [20]. In the present study, we demonstrated that GDF15 served as carcinogenic factor in CRC cells (LoVo). In addition, GDF15 could improve cell viability, invasion and migration in vitro. The EMT-related factors, N-cadherin, vimentin and Twist1, were up-regulated by GDF15 overexpression, whereas E-cadherin was down-regulated. EMT-dependent invasion and migration is characterized by increased vimentin and loss of E-cadherin. The loss of E-cadherin expression is considered a crucial step in the progression of carcinoma invasion, and it is a fundamental event in EMT. Based on these observations, we concluded that GDF15 might be a positive factor of CRC invasion and migration via regulating EMT-related factors.
EMT, one of the central mechanisms that induces invasion and metastasis of tumours, is a process by which epithelial cells lose their polarity and are converted to a mesenchymal phenotype [21–23]. EMT is associated with loss of the cell–cell adhesion molecule E-cadherin and disruption of cell–cell junctions as well as with acquisition of migratory properties, including reorganization of the actin cytoskeleton [24,25]. A recent study demonstrated that IRGM1 enhances B16 cell migration and invasion via the induction of F-actin polymerization and EMT [26].
Furthermore, in terms of that most of human malignancies arise from the epithelium tissues, the investigation of EMT will be beneficial to not only CRC but also the bulk of solid malignant tumours. Growing evidence elucidating the biochemical architecture on how EMT potentiates cell migration and metastasis have been discovered. Herein, we showed that GDF15 overexpression mediated the decrease expression of E-cadherin and simultaneously increase expression of N-cadherin, the mesenchymal marker vimentin and Twist1. The loss of E-cadherin expression is considered a crucial step in the progression of carcinoma invasion, and it is a fundamental event in EMT [27]. Based on these observations, we concluded that GDF15 might be a positive factor of CRC invasion and migration via regulating EMT-related factors.
In conclusion, our results uncovered a novel and unexpected regulatory function of GDF15. Our results also shed light on the critical role of GDF15 in the induction of EMT and in the metastatic phenotypes in CRC. Thus, our data imply that GDF15 plays an important part in mediating CRC growth and progression and may serve as a therapeutic target for CRC.
Related Research Data
Disclosure statement
No potential conflict of interest was reported by the authors.
References
- Siegel R, DeSantis C, Virgo K, et al. Cancer treatment and survivorship statistics, 2012. CA Cancer J Clin. 2012;62:220–241. [Crossref], [PubMed], [Web of Science ®], [Google Scholar]
- Saika K, Sobue T. Cancer statistics in the world. Gan Kagaku Ryoho. 2013;40:2475–2480. [PubMed], [Google Scholar]
- Jemal A, Siegel R, Xu J, et al. Cancer statistics, 2010. Cancer J Clin. 2010;60:277–300. [Crossref], [PubMed], [Web of Science ®], [Google Scholar]
- Ago T, Sadoshima J. GDF15, a cardioprotective TGF-beta super-family protein. Circ Res. 2006;98:29–297. [Crossref], [Web of Science ®], [Google Scholar]
- Wang X, Li Y, Tian H, et al. Macrophage inhibitory cytokine 1 (MIC-1/GDF15) as a novel diagnostic serum biomarker in pancreatic ductal adenocarcinoma. BMC Cancer. 2014;14:578. [Crossref], [PubMed], [Web of Science ®], [Google Scholar]
- Staff AC, Trovik J, Eriksson AG, et al. Elevated plasma growth differentiation factor-15 correlates with lymph node metastases and poor survival in endometrial cancer. Clin Cancer Res. 2011;17:4825–4833. [Crossref], [PubMed], [Web of Science ®], [Google Scholar]
- Lee DH, Yang Y, Lee SJ, et al. Macrophage inhibitory cytokine-1 induces the invasiveness of gastric cancer cells by up-regulating the urokinase-type plasminogen activator system. Cancer Res. 2003;63:4648–4655. [PubMed], [Web of Science ®], [Google Scholar]
- Wallin U, Glimelius B, Jirstrom K, et al. Growth differentiation factor 15: a prognostic marker for recurrence in colorectal cancer. Br J Cancer. 2011;104:1619–1627. [Crossref], [PubMed], [Web of Science ®], [Google Scholar]
- Thiery JP, Sleeman JP. Complex networks orchestrate epithelial– mesenchymal transitions. Nat Rev Mol Cell Biol. 2006;7:131–142. [Crossref], [PubMed], [Web of Science ®], [Google Scholar]
- Yang J, Weinberg RA. Epithelial–mesenchymal transition: at the crossroads of development and tumor metastasis. Dev Cell. 2008;14:818–829. [Crossref], [PubMed], [Web of Science ®], [Google Scholar]
- Peinado H, Olmeda D, Cano A. Snail, Zeb and bHLH factors in tumor progression: an alliance against the epithelial phenotype? Nat Rev Cancer. 2007;7:415–428. [Crossref], [PubMed], [Web of Science ®], [Google Scholar]
- Thiery JP, Acloque H, Huang RY, et al. Epithelial–mesenchymal transitions in development and disease. Cell. 2009;139:871–890. [Crossref], [PubMed], [Web of Science ®], [Google Scholar]
- Mendez MG, Kojima S, Goldman RD. Vimentin induces changes in cell shape, motility, and adhesion during the epithelial to mesenchymal transition. FASEB J. 2010;24:1838–1851. [Crossref], [PubMed], [Web of Science ®], [Google Scholar]
- Yang MH, Wu MZ, Chiou SH, et al. Direct regulation of TWIST by HIF-1α promotes metastasis. Nat Cell Biol. 2008;10:295–305. [Crossref], [PubMed], [Web of Science ®], [Google Scholar]
- Mark P, Leav I, Pursell B, et al. ERbeta impedes prostate cancer EMT by destabilizing HIF-1α and inhibiting VEGF-mediated snail nuclear localization: implications for HIF-1α and inhibiting VEGF-mediated snail nuclear localization: implications for Gleason grading. Cancer Cell. 2010;17:319–332. [Crossref], [PubMed], [Web of Science ®], [Google Scholar]
- Zhang W, Shi X, Peng Y, et al. HIF-1α promotes epithelial– mesenchymal transition and metastasis through direct regulation of ZEB1 in colorectal cancer. PLoS One. 2015;10:e0129603. [Crossref], [PubMed], [Web of Science ®], [Google Scholar]
- Cheung PK, Woolcock B, Adomat H, et al. Protein profiling of micro dissected prostate tissue links growth differentiation factor 15 to prostate carcinogenesis. Cancer Res. 2004;64:5929–5933. [Crossref], [PubMed], [Web of Science ®], [Google Scholar]
- Albertoni M, Shaw PH, Nozaki M, et al. Anoxia induces macrophage inhibitory cytokine-1 (MIC-1) in glioblastoma cells independently of p53 and HIF-1. Oncogene. 2002;21:4212–4219. [Crossref], [PubMed], [Web of Science ®], [Google Scholar]
- Li PX, Wong J, Ayed A, et al. Placental transforming growth factor-beta is a downstream mediator of the growth arrest and apoptotic response of tumor cells to DNA damage and p53 overexpression. J Biol Chem. 2000;275:20127–20135. [Crossref], [PubMed], [Web of Science ®], [Google Scholar]
- Zhang L, Yang X, Pan HY, et al. Expression of growth differentiation factor 15 is positively correlated with histopathological malignant grade and in vitro cell proliferation in oral squamous cell carcinoma. Oral Oncol. 2009;45:627–632. [Crossref], [PubMed], [Web of Science ®], [Google Scholar]
- Wu Y, Peng Y, Wu MY, et al. Oncogene FOXK1 enhances invasion of colorectal carcinoma by inducing epithelial mesenchymal transition. Oncotarget. 2016;7:51150–51162. [Crossref], [PubMed], [Google Scholar]
- Zhang WJ, Jiang B, Guo Z, et al. Four-and-a-half LIM protein 2 promotes invasive potential and epithelial mesenchymal transition in colon cancer. Carcinogenesis. 2010;31:1220–1229. [Crossref], [PubMed], [Web of Science ®], [Google Scholar]
- Peng Y, Zhang P, Huang XT, et al. Direct regulation of FOXK1 by c-Jun promotes proliferation, invasion and metastasis in gastric cancer cells. Cell Death Dis. 2016;7:e2480. [Crossref], [PubMed], [Web of Science ®], [Google Scholar]
- Li QW, Mattingly RR. Restoration of E-cadherin cell junctions requires both expression of E-cadherin and suppression of ERK MAP kinase activation in Ras-transformed breast epithelial cells. Neoplasia. 2008;10:1444–1458. [Crossref], [PubMed], [Web of Science ®], [Google Scholar]
- Vandewalle C, Comijn J, Craene BD, et al. SIP1/ZEB2 induces EMT by repressing genes of different epithelial cell–cell junctions. Nucleic Acids Res. 2005;33:6566–6578. [Crossref], [PubMed], [Web of Science ®], [Google Scholar]
- Tian LL, Li LX, Xing WJ, et al. IRGM1 enhances B16 melanoma cell metastasis through PI3K-Rac1 mediated epithelial mesenchymal transition. Sci Rep. 2015;5:12357. [Crossref], [PubMed], [Web of Science ®], [Google Scholar]
- Zhang WJ, Feng ML, Zheng GP, et al. Chemoresistance to 5-fluorouracil induces epithelial mesenchymal transition via up-regulation of Snail in MCF7 human breast cancer cells. Biochem Biophys Res Commun. 2012;417:679–685. [Crossref], [PubMed], [Web of Science ®], [Google Scholar]